CBrugiaQ_159


Sequence

>CBrugiaQ_159 (2 EST) Length=832 GCTAACTTATTTAGATGATAAATTGTTCCAGGGAAAGTAACTTTTTATTCATGGAAAGGGTGTTAAACAAATGCAAACAT TAAAATGGAGGGAAAAAGTAAAATTCGTTCCCTTTCTTCACCTTCGTTTAGCTTCACGGAGATATCTATGATTAATGTTG CAATCTTCGCAACATCACATTTGGCGAGTTTTTGGCGGAGCTGATAACGTGTAGCTGATAATTCAGGATTGGGCGGCAAA AAAACAGCGACACAGTGATCATTTCCTAGAGAGAAGGGCTGGATTCCTTGAATGACAGCATTCCCAAGCCGTTACTGTTT CTCGGCGATCTACACTAGTAATTCAAATTTCCTAGAGAGAAGGGCTCGATTCCTTGAAAGACTAGCAAACAAAAAAAGAT ACAAATGCTCGAAAATACAACCTCATCATAAACATCTTGAACAAAACGTTCAAAGTAATACGAAGGAAGAGAACGAAGAC GTCGTCGAGCTGATTTCATTTGCACATTTTCAGTGTACTGTCCTGCCAACTCTGGAATCAAAAAATACTGTTGCTTAGAG TGATCTGGTCGTCGTCCACATAAAAACATTGTCAAACGGTTGGTAACTTCAAACTGGAGTTGTTCCAGTCTTGCAGCGAG TTCGATATGATTTTCAAGCTTTGCCACTTGAGAAGGAGTCAAGTCTATGGCATTCAACTGTGCAGGATCAGCTCCATAAA TCCAAAGTAATTCAACCTGCAAAGCTTGATTTTCTTTGGCTGAAACATGGAGGGGTGTATTATGCTTTTCGGGATCTGTG TAATTCGGATCAGCACCCAATGCTAATAACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_159: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675031849733AA228175SWMFCA1065SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10859992153583AA441705SW3ICA2522SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:59:24 on Sun 19 Nov 117.