CBrugiaQ_1597


Sequence

>CBrugiaQ_1597 (3 EST) Length=439 GTGTGAGATTTCAAAAGAAAAAAGAAAGAAGGAAAAGAAAGGATTATTAATGCTAGGATTGTTGACAATTACAAGTGTAT TCCGAAATTGGCGGAATAGTTTGCAGCGCAAAGAGGACTACGATGAGTGCCATATGAGAGGAATAAATAATGAAAATGAA ATAAGTGGTANAAGTGAAAAAAATTTCAAATTAGATGAACCACCANTTTCGTTAGAAACAGTAATGGCAGAATTCANATT GTCAAATGAGACACTTCGNCGAATGATGGCACATATGTCTCGTAATATGGACAAGGGTCTTGAAGGTGGACCCGAGAATA GCACCATATCAATGTTACCATCTCTTGTACCTGAATTACCTAATGGAACAGAAGAAGGTCGATTTATTGCAATGGATTTG GGTGCGTACCAATTTACGTGTAATGTTAATGGATATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1597: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304311300181W23327SW3ICA1456SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304321300182W23328SW3ICA1457SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11535902246804AA508927MBAFCW1C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:0:56 on Wed 22 Nov 117.