CBrugiaQ_1599


Sequence

>CBrugiaQ_1599 (2 EST) Length=440 CGTTTGGAGAACGATGGTAGTAATTGCATATTTATGAAACCGGCAGTCTAATACTTTTGAGGTTGAAAAGCGCCATTAAT TTTTAATGATTTCTCTACTGAAATAATGAGCACACCCTGGCGATATATTTGTGGAATCGTCTCAAATTGAAGAAACACCA CAAAGTGACCATGTGCGAATATTGGTTGCTACCGATTTACATATAGGATGTGCGGAGAAAATTTTGGGTCGTAATGAAGA CTCGATAAGAAACGTTGGAAGAAGTCCTCACAAATTGCTAGCAGAGAAGAAGTGATTTTGTCTTACTGGGAGGTGACCTG TACCATGAAAATAATCCATCTCGTGAAATGCACACCGCGTTAACACGATTACTTCGTCAATATTGCCTGAACNATCGTCC GGTACTCTACCCTTCCTAGTGGACCCCGCTGTAATTTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1599: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343518973922R95192SW3ICA356SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7092451613919AA074015SW3ICA1670SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:34:59 on Tue 21 Nov 117.