CBrugiaQ_160


Sequence

>CBrugiaQ_160 (6 EST) Length=674 TGCCCGGGNATAACCTGGAGGCCTTTCATTCCCGGGGNAACCAATTCGTCCTGGGGGGTCCNGGTGGTCCTGGAATTCCA GGNTCACCTGGTGCTCCATCAGTTCCTGGGCATTCCCTGCATCTCCGTGGGAGGTCCNTGGTGGCCCCACGTGGTCCTGG ACCACCTGAAGGACCCTGCTGGAGCATCACATGGACATTGTTCTGGGAAACGTTGTGACCATTCTGGTGGTTCTATTGCT GGTGTTCCCTGGCAATCCAATATCACCAATAACACCATCGATACCATCCACACCATCAGGTCCTGGTTCACCAGGTGGTC CAGGTGGTCCCACGTTGACATGTACAACACAGGCCCTGATTTTTGACGTCGTCNACGATCTTTCACTTCCGTCACAACAC CGTGCAGTATCTTTGCGGCACGACTAACACGTAACGCTGTCAACTGCTTATCATTAGTTTTCATTTCAAGCATTTCTTTC CACATATTTCTAGCACGCGTCTTGCATAAATCTAATTCCGTTTGCACATGACTTTCTAATGATTGAATATAGGTAAAAAT AATTGGAAATGAAATCATGCATGAAGTTATAGCACCAGTAGCTAATACAATAGCTATAAAAGCATTTGTTTTCATCGAAT GTGGACGTAATTTTTTTTCCATTCCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_160: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343523973927R95197SW3ICA364SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427411164889N41291SW3ICA1021SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445661167367N43065SW3ICA1112SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390401795705AA199962SW3ICA1998SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8948791888304AA253956SWAMCA666SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12617962392992AA585580SW3D9CA242SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 17:14:57 on Fri 24 Nov 117.