CBrugiaQ_1602


Sequence

>CBrugiaQ_1602 (3 EST) Length=442 AACGGTAATGGGATCGGAGTAATCATTTTGAGTTCGGCACGAGGGTAATGGGATCGGAGCAGTTACAAAAAACACGTCAT GCTCAGTTTGTCGTGAAATCCACACTAAAATCAAAATAGACGGGAAGGAATGGAAAGAAAGAAGGAAGAGAAGAAGCGGC TTGCGAAGAAACTTTGAGAAATGAAAAAGTGTGTGTTTAGAGGAGGAGAATGGTTAGATTTCATTTTGAATATCCAATAA ATTTTGGTTTGGTGCAATGTGGTGAGGATCAAGACAAATGGCTTGAGAAGGATTGCATAAAAAAAGTGAACCATCAACTG TAAATAATGAATTTNTTGTTGATAATATTATACTAATCGAATTTCTCGCTAATTTCACTTTTGTCAGTTTTAAACTATTC ACCCCATACAAATTAGATTAGTAATAAATGCTGAAATGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1602: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304581300208W23354SWAMCA498SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304681300218W23364SWAMCA515SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774532125757AA433159RRAMCA1599SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:16:58 on Thu 23 Nov 117.