CBrugiaQ_1609


Sequence

>CBrugiaQ_1609 (2 EST) Length=605 GATTTCCTTGTTCTAACCCAATGAACCTTGTATAAGACCAAACATGTGACATTTTTGTGCTATTTCTACAGATTCTTTCC GTTTTTTCGTCATCAAATCAAAATCATATTCCTCATGCGTGAACCTCTTCGAATATGGATCATACTGATAAGCAACAACA GATGGATTTTGAATCATTACTGACTCCAAGTGAAATCGTCCATCCCCCAAGTATATAACTGCATCGACATCCTCCTCTAA GTGGGGGAAGATGTACAACCAAGGATTTCACCAGGACTAAGAGGTTTCACTTGTGGTATCAAAATATTATAACCTTTGCC AATTAATTCTTTTTTAACACTCTGCAAGCAAGGAACAAATTGGATGGTGCTAACTAATGCAAGCTTTTTATGCTTTTCGA AATTAGCTTCTAATACATCAATAAAATGGCCAACATTCATTTCGATGTTTACAAAAATATAAAGCATTTCAATTCCTTGA GTTTCTTGAATTGGTATCAAGTACATTATAGCTGTTATAATGAGCCGTTCGCGGTTTCACCATTATAGGTTTATTTGAAC TTAGACATGCATGGCTTAGCCTTTGAGACAAGCATATAACCGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1609: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406811313859W32829RRAMCA1207SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9246541927224AA283566SW3ICA2711SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:40:42 on Tue 21 Nov 117.