CBrugiaQ_161


Sequence

>CBrugiaQ_161 (2 EST) Length=696 CAGACAATACTATTGTTGAGGAGCCAACTTCCTAGGAGGTTGACTTTTCCAGAATAAATTTATTTATTAAGATGGATTTT GAAATAATAGTTCAAATATTATACATTTTAATTCTAAATTGTCATTGCTTATATTTCATCCTCAGAAGTTCAAAGAAAAA AAATATATAAAAATTTTTCCAGACTTGTCTACTTATATGTTCAAATATGTACCCATTGTAAAAAATTATTTAAAAGGAGT AAGATAGTATTTTAAAAATATGAAACATGATATTTTTGTTTTCAGGGTAAATACAATGACCATTAAGCTATTATTAATAT AATTAAATTACCAGAGTAAGCTAAACACATGCTGAATTAAATGACCAAAGTGTAAAATGTAGATTTCAAAGGTTGTTTAC CTACTTATAGGATATTGAATGTAAGTGGGCATAATTAATTTTATTTCTTTTATGATTTTTAAAAAAGACTAAGAAGGTTT TGATATTATACAATAAATGTGTTTTAAATCTAGTTTACTGTATGTAACCTATAATTCTAAGAACATTCAGTCATAAAAAT GGACTTATAGCAAACAAAAAAAACCGTCATCAGTTATGTGTCTTTCGACAACTGATGAAACATGACCAGTGAATACCTAT CTTGCCATTAATGATCAAATATTTATAATCGTATGAGTTTCATGATCTACCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_161: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212352344729AA570839SWMFCA2601SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212362344730AA570840SWMFCA2602SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:45:30 on Sat 25 Nov 117.