CBrugiaQ_1612


Sequence

>CBrugiaQ_1612 (2 EST) Length=437 TAACGATAATGTATTATGGAAATGAGGATAACTCGTGGAAAGATGTAATAAAGGATGTCCTCGATATGCTTGGTGGTGTG ATAAGTAGCGAATCTTGGAGGGATAATGACATGATAGCAACGATTGATCATATAGATGGCAAGGAACCCACTTGTTCTAG CAGCAAGGATGGGGCAGATACATCATCTGTAAATGAGGGAAATGATGATGACTGGACAGCGCGACATTATCGCATGGGTA TTGCTGCCTTCCTCAAACAAAATTCTCGACTAGAAGGTGTGTCTTTTAGAAAAAGGAATGTGAGCGTACTGTCAGAAAAA GAAAGTTGGTAATATTTCTTCAAGTTAATATTACGAATCCGGAAGGCCGATGATAATCCAGGAAATACGAAAAAAGATTG CACGACCACAATATTCCAATTTCAAAGAAATTATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1612: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939751081964H91534SWMFCA120SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7621071681975AA123680SW3ICA1909SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:44:27 on Thu 23 Nov 117.