CBrugiaQ_1614


Sequence

>CBrugiaQ_1614 (2 EST) Length=437 AGATATGAAGACGTTACCGTTATTTCTTACTGTGGCACTTCTGGTTGTAGACGTCTCCTCACGACAAGGAGAAGATGGTA AGAAAGATGATGTACATGGTTCGGACGATGAAAAAAGTACGAAATATGGAACAATCATTGGAATCGATCTTGGCACTACA TATAGCTGTGTTGGAGTCTATAAAAATGGACGAGTGGAAATTATTGCAAATGAACAGGGTAATCGGATCACGCCATCATA CGTAGCATTCACTGGTGAAAGCGGTGAGCGTCTTATTGGTGATGCAGCCAAAAATCAGTTAACAACAAATCCGGAAAATA CTGTTTTTGATGTTAAACGTCTGATTGGCCGAGAGTACAAGGATTCAACTGTACAACAAGATATCAAACATTGGCCTTTC GCTGTGAGTTTTATTTACTGATTTAAGAATTTGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1614: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320258945459R86432SWAMCA415SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777072130890AA433413SWAMCA1888SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:22:30 on Sat 18 Nov 117.