CBrugiaQ_1629


Sequence

>CBrugiaQ_1629 (2 EST) Length=450 GGGAATTTCCTTTCATTCTTTTTTTNAAACAAGCGGATGTGGGAATACCATCATCGCTGGCTTGGGGCTTCAATAAACAT AATCCATAATTCAACCCATAAATTCCCGTGCTCGTCGAGCATTGAGAAAGCCAGTTAAATTAATCTGCATCAACTTTCGG ATTCAACGATTTCTCCTCCAGTTGACTGAATACATATTCAATGACAACATCGTCTTCTATGCCCAAAATGTCATTCAACT TGGCAGTAATCCACGGTTTGAGCACATCCAGATTCACTCGATCCATGCAGATCTTTTCGTCCAATGCTTCCTCGAAACGC ATTTGCTTCAGTAACTTGCGTTCCTTATCGGTGAAGCGACTATCTTGCTCACTACTTGTACCACGATAAAAGCCTGCGTC AGCCATTTTATCTNCCTTGTCAAAGTAATAGTTTTGACTGCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1629: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272621634907AA089428SW3ICA1799SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8854661876870AA246062SWMFCA1168SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:38:16 on Sat 18 Nov 117.