CBrugiaQ_1633


Sequence

>CBrugiaQ_1633 (2 EST) Length=447 AATTATTTAAAATTAAATTAAATTTTTAAGATAAACCAAAAAGCCAATCCCCTTAATAAATCCAATGAAATCCAAATGAT TCTTAATATCACTTGAACTTATAGGAAAAATTGATTTGGAAAATAAACTTGTAGGAAAAAGTGGGTTTTAGAAGTCAATA CAACGTCCTTTCCGTTCCCAATCGCCCAAAACGGGTCGGTTCCGGTCCCGCTGGCCCACCAATTTCTCCGGTTATCGGGT TGACGCCTCCGGGATGCTTTGGGAGATATGGGTCTTCATAAGGCTTATCCTCCTTTCCCGTTCCCAGCTCATGATCCATC TTGCATCGTGGTGTTTTCTTCTGAATCTCAATCTCCTTTTCATTTATAGTACCTCCTTCAAATCTACAAAAACGTTGCTG ATTGCAAAATATTTGCATAAGGCCCCGACCACGAACTACTCGCAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1633: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939581081947H91517SWMFCA101SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8982321892837AA257361MB4SLM1H12T3Brugia malayi L4 JHU93SL-BmL4


Date: 1:18:0 on Tue 21 Nov 117.