CBrugiaQ_1638


Sequence

>CBrugiaQ_1638 (3 EST) Length=438 TTTCGGGCAACGGATTTATCACAAAGAAATGTACGAGAACAAATTTGTTTATAAGAAACATAAACAAATTACTAGCTAGT TATTTTGAGTCATTTGTCGCGCATGCTGGGTTTGTAACGGATATTTTGCGCTTTTAATTCTTGAACTATGTGAGATGGCA ACGTACCGGAGACCGAAACTGCGTAAATTCCTTTCACTTTACGGTTAATTTTTTGCCATTTGCATACCCAGGATTCTTCC GGCACCGTCGCAGCTATCATTCCATCAAAATTTGAACTAGTGCATTCGCTAACTTTTTCCTCATCGCCCTTCATCCCCAA ATATCTTTCACAGTTATCACATCCATCCAATTCAAACTGCTCCACACTCTTTATCATTGAACATAGTAAGCAAGCTCGTA AATTACGCAAATCACGAGGTATACTTTCTACAGACATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1638: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217640808462R47575SWAMCA078SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8987771893382AA257866MBL2SJ4D12T3Brugia malayi second stage larvae JHU96SL-BmL2
11887602289624AA542712MB4SLY2D06T3Brugia malayi L4 JHU93SL-BmL4


Date: 19:31:51 on Sun 19 Nov 117.