CBrugiaQ_1639


Sequence

>CBrugiaQ_1639 (2 EST) Length=437 ATCTGTATGACAGAAAAAATTACGCAAATTTGGGAAACGAATATAGATGCTGAAAATGCATCAAAGAACCAATTAATTAT CAGTAATGAAATTACGGATCCAATGACAAATGTAAATGATGAGCGTATTGCTGCGAATAATCAAACGCAATTTTACCTGG AAAATCACTTGGATCATCTGGAAAAACGTTGTAAAGAAAGTAAAGAATTTCAAACAGATGCAATCGGAAAGGAATTCATA ACCAGATCTATAAAAACAGATCAGAAAAATGAAAATGAATCGGACAAAATTGTAGATGACAAATTAAACAGCTCACCAAC TGGAGAAAATCAAATTCAATACAGCTGAAAATACTTCATTCAATAAGTCGTTAACAGCAATAAATTCTTTCTACAACTAG TNCTGGACGAACACCACCCTTGGGGCAAATCGATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1639: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6378811488480AA023864SWAMCA1054SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6378821488481AA023865SWAMCA1055SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:26:31 on Thu 23 Nov 117.