CBrugiaQ_164


Sequence

>CBrugiaQ_164 (4 EST) Length=691 ACTGTCGAGAATTTTTCTCGACAACTCCATTCTTTGAAACATTTATATCATTAGTTGTACAATGAGTCGCAGGATTGCAA CTTTGCACTCAACGGGCAAAAAAACCAGGAGCAGGAGCAGTAGTCCGTCTAGTAATGATGGGAAGCGCCAGCAAGGATTT TATGTCGGCGGTAGCGAACAGAGTGGAAATCTAGTGCTTGAGCCAGATAGTTCACGTAACGAGGATTTCGTTTCACAGTT CTTCAATTCAGCTCGTGCTCGTGGTGCTGAATCTCTGACACCAGAAGAATGTACAAAATCAGGAGCTCATGACATAGTGA AGTTATCTTCGGGTATTAAAGGTTACCGTTTGGGGGGTGCTGTTCAACAACCATCCGAGTTGGTTGAATCAAATGGTTCT ACTCCACAAGATGTGACACTTGTCATGTGGGAAAATGGATTTACTGTAGATGGTGGTCCACTTCGATTGTACAGTGACAT GCGAAAATCATTCGTTTTTACAAACGATTGGCGAAGGACGCCTTACGGGGCGAAATAATACGGCAGTATCCGGGGCCAAA ATTATTTTACCCTTCCAAATGGGAACGTCCAAACCAAACCACGTGTTAGTTGAATCCGAAGCCCCTCTTACTGGGAGAAG GGGCCGAAAATTAAGGTGAACTTGGTGCCAACCCGTTTTTTTTCCAACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_164: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7621041681972AA123677SW3ICA1905SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8856121877016AA246195SWMFCA1716SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10482942064941AA406949MBAFCZ7B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12618252393021AA585609SW3D9CA320SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 0:35:24 on Sat 25 Nov 117.