CBrugiaQ_1644


Sequence

>CBrugiaQ_1644 (2 EST) Length=434 CAGGTGGAAGTTTTTAGAATGAGTTTGGGCAGCCATGCTTTAGTTGGTTCATATGCTGTTCTTAGCTCCCAAGGTGCTCT TGTTGAAGCAAAAACTTCTCCTCAAACACAGCGTGAGTTAGCTGCTTTAATTCAGGTCCCAGTTGTCGCAGGCACCGTCA ACAGGGGTTCGGACCTAGTTGCTGCTGGCTTATGTGTTAACGATTGGATCGCTTTTGCCGGTCTCGACACGACAAGTACA GAATTATCAGTAATTGAATCTTTATTTAAACTTGGTGATCGTGAGGCATCAGCTATAACCAGTGACATGCGGGATGCTCT GATTGATAGTACCATGTAATGGAAGATATATATCTACGAGGAATAGAATGTGATTTCTCCAGAAAAAATATGCCCACCAG GATTAAAATCCCATATGGTCTTCTTAATCTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1644: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014691266990N94645RRAMCA1184SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6675191531529AA051823SWAMCA1454SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:2:31 on Tue 21 Nov 117.