CBrugiaQ_1645


Sequence

>CBrugiaQ_1645 (3 EST) Length=427 CGGAGCCCTGTNANGAACTTNCAANGNGGNGGCGCTTANNAACTTATCCNGCAGGATGTCTTGCTNATGTTNCCTGGNGA TTAAAANATNANAAAGATANTACAACACTAGGANGTGGATGTTAAAGGTATCCCAGCGACAGAATATGACGGTACTGAGA ACGGTTTGCATCGTTTTTATATACNGAACATAATGAGGACATTTGGATTTGGAGCGCATATTTTCTGAAGTTCGTGCTTT AGCACTTTTCAACGATCATTTACTAACCAGTACGCAGTGGATTTCTTATTCTTGCTTATTTTATTTAACATTATTTGAGA CGAAATTCAGTCTGAAAGCTTGGTTCCACATACACTGCAGCATATTTGTGCTGGAGATGAATATAAATCTGTTGTTCAAA TTCTTGTCAATAAAAGTTTTGCGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1645: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984681893073AA257597MBAFCZ1G6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537442246958AA509081MBAFCX7A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212802345177AA570884SWMFCA2649SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 3:54:7 on Sun 19 Nov 117.