CBrugiaQ_1649


Sequence

>CBrugiaQ_1649 (2 EST) Length=441 ACGGATGGGAAGTGTGCCGCAGGCCGATTGGATCTGTCTTTATAAACAGCTACTGAGGTCGGCCTCACAGTTTCCGCAAT ATAATTATCGAGAGTTTTTCAAACGAAGAATACGCGACCACTTCACGATAGCAGTGAAAAACAACAACATCTCAAAAGCC GAATTTTACACGAAGTGTCAAGAGCTGCTGCAAGTAATTCGGCGTCAATCCACTTTATACCAGAGTTATCCTGTTTCGAA ACTTGTGGTGGAGGGAAAAAGTCGTGATAAAGAATCCGCTCATTGACTTAGTAAGAGAATCACATGTATGAAGCGCGATA GAGATCCGCGAATGTCCANAATGTAAAGCTAAGGAATACAATAACCGACGATGTTGGNTGATGATTAATGAGTGTGGTCA TCCATTATGCAGGAACTTGTGTGGAAATCTTGTTGGTCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1649: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445401167341N43039SW3ICA1035SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8984591893064AA257588MBAFCZ1F9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:57:37 on Fri 24 Nov 117.