CBrugiaQ_1658


Sequence

>CBrugiaQ_1658 (2 EST) Length=433 ATCTTCGGGAAATGTTCTGTTGTTTTATGGTATAACAAAGTTCGAAATGTGGGGGTTGATCATATTTATCACATGGTCAA TATTCTGGGGGGATTTCTATCTTTCTATACGACAGTATCGCGTCCATCGTGATGCAGTGAAAAGGCCAGATGAAGTGAGC GAAATAATGAGTGAAGAAGAATATCGAAAAGCTCGGATATATAGACTTGACAAACATCACTTTTCTGTCGCCTACTCTAT ATATGCGCAGCTAGAGTTAATGGTTATTCTGATATTCTATCCACCTCAAATTTGATGGAGCAAAAGTGGAAATATCAATC TGAGATTNGGGTTTACAAGCGAAATTGCACAGACAATAACCTTTATATCATTAGNATCAATTATCGAATGTCTAATGAGT ATACCATGGCAGCTTTACGATACATCCGTCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1658: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939741081963H91533SWMFCA119SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10614592078609AA417399RRAMCA1424SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:46:34 on Sun 19 Nov 117.