CBrugiaQ_166


Sequence

>CBrugiaQ_166 (3 EST) Length=704 ACATGTCCATGTCCACCAATTCAGTTCTTATACGATGTATCAGGGCATTGAAAGCAATTCCATCACCCCAATTTTTATCC ATATCAGTCAGATGGATATTATTAAGTTCTGGCAAGTTGGGCATTAACCCTTCGTAATAATAACACGATCAACAGGGGCT TTTAGACGTCCAAAACGTAACTGATGTGGTAATTTACCCAAAGGGACTATTTCCCGTTGCCAATTCTAGACGTTGATGGG CTATTGGCCAATTCTAGCTCAAATCCCCATTCTTTCAACAACTGGACGTTAGTCTCGATCTGGAAATGAAGGATCATCTG CCAAATGAGTCCACAAATTATTCGGAGGATTTCCATTGGCTATATCTGCTGGATTATTGTTCACCAAATCAAGACCGCGA CGTCGCAAAGCTGCTAGTGCTGTTGTTAAATTGCTGATATGGTGTACCCGTTTTGATTCTTTTGCCTTATTAATTGGCAG TGCTTCACCGGTAAGAACTTCGATAAGATGGCATAATAATACACCATCTCTGAGATCCTCAAATAGATCTTCCACCAGTT CTGACGAACTATGAGTTTCAAGATGATAATTGACCCATTTTGTAAATGTCTTCTTTTGCATCTCATCGTGTTCATCTCNG AAANATGGATAGCATGTACAGCATGATGCGGACATGTATCATAAAATGCTCGAATCCTGCACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_166: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320180944796R86390SW3ICA339SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8249001769729AA185841SW3ICA1938SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8639391845387AA224603SWMFCA1034SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:41:33 on Sat 18 Nov 117.