CBrugiaQ_1660


Sequence

>CBrugiaQ_1660 (4 EST) Length=539 TTCGTTACAATACTTCTCGTGCATTTGAAGTTCTCACAAAGATCAATTGAAAAAATGTAAGACGAATCTTACAAAAAAAT GAAGTTAGGTCTGATTTGTCTTCCCCTTGTTGAATTTGAAATGACTCCCCTGAGAGAGGAAAATAAGAATGAAAATCATA TGCATGAAGTGAAACATCAAATAGCAACCAGCGAATAACCAAATGCCGATAAATTATCAGTAGCAATAACCATGCACAAC GATAACGAGAGACTTCAATTTCAATGTTGCATTTCGCTACTTTCTTCAGCTCCACCAACCCACAGTACATTGTTGCACCT AATTAAAACTTCTCCAACATCACCAGTATGTCGACCATCTATGTATTCTTCAGCGTTGGCTAGTTGCAAGTTCATGTAAC CATCAACAGAAACAAGGTACCCTTTATATTCCATACCCCATTTCAGTTTGCAAACAACCGGTTTGCCGGTTAGTCCATTC AAGAATGGCTTTGGATTAACTGGTTGTAGTGTCGTCATCGTCAATACTGTACCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1660: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8557881817191AA216487AS4SLC662M13RBrugia malayi L4 JHU93SL-BmL4
8558131817216AA216476AS4SLC659T3Brugia malayi L4 JHU93SL-BmL4
10481412064788AA406796MBAFCZ4G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162142199355AA471591MBAFCX4C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:47:48 on Fri 24 Nov 117.