CBrugiaQ_1664


Sequence

>CBrugiaQ_1664 (2 EST) Length=684 GACAACAGTTTTTACTGGAGATTTCTGATCGTAGTTCAGTAAACAAGATTCAGTGACGTGAGNAGGACCAATAGTTGACG CAGTCGACGGTATTTCCATGTTTTCTGACAGTACTGTCCAGCCTGNNCGGCTAGACGAAGTTGTTGGACTTGCTCTGTCA GTAAATCCCGAATTTCGCCGTTCAGCTTCAAGTAAACGAGCTCGACTCTTTTCCACTGCCGATTCGATACTGTCAACCAC AAGTCCCGTNCATTTGGCATCTTCTAGANTGAAATGATTTGCGGATCGTTCACCGTCATACTTCGAAAATGAACCTGAAA TCGAATTTTGTAGGCTTTTAGTGAGTATATGACGAGCACGTATAAGGCTAAATTTTNCTGGGTGGTAATTTGATTAGGCC AGGTAATCTATCTCGTGCCGAATTCGGCACGAGTATACAAGCAACTTCCTATCTCTGTTGGGACATATTGCACAATTTTT ATTATGTGCTATTTATTAATATGTATTTAGCTCATTATTATTGTCTCTGTATGTATTCCTCATTTGGTTTTTTCATATGT AATAGGCCAAAATTCATTAAGTGACTAGTGCACATGTTGTTGACTATTTCTTATAGAATCTCATTGGTTTTCTAATTGTG GCGGTTGATTCTCAAAACTATCTATATATGTGGAACTGTGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1664: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809711236208N74809RRAMCA1080SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7244671631377AA088150SWAFCA012SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:53:43 on Tue 21 Nov 117.