CBrugiaQ_1668


Sequence

>CBrugiaQ_1668 (20 EST) Length=458 CCCCCCCACATGGTTTGTGAAGGTTTATAATCCGAATTTTGAAACGCACACATGAATAACATAACAATAAGAAAAACAGT GAAAGGCTTAATCGAACAATCCAAATCCCATGTCTTCGTCAGATTCCTCTTTTGGTTCTTCTTTCTTCTCTTCTTTTTTA GATTCCGCTTGTAACGCATCAGTGGGAGTTGCTGAAACGACTGGAGCTATTGCTGACACTGCAGCATCTGAAGGCACTGA TGAGATCTTCGCCAGACCTGCTGTAATTACCTCATCAATGGATTTCCCAGATAAGGCTGACACGACTTTATTCGCATCTT CCATATCAACATCAAGTCCAACTGATCCAAGCACATCCTCTATATCTTTTGCTGTCGGTGATTTGTTTCCACTCATTGTA GATAATAAATAAGCAGCCAAATACTTCATCATAACACCTCAGAACTTGGGTAATCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1668: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1031235
1435268
1435317
281850890034H21339AS3ISB343SLBrugia malayi infective L3 JHU93SL-BmL3
4576411193278N52112KJ4SLB174T3JHU93SL-BmL4 (JHU)
6722851537232AA052054SWMFCA780SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7062421592660AA072559MB4SLD070T3Brugia malayi L4 JHU93SL-BmL4
8678731850638AA228532KJ4SLB305T3JHU93SL-BmL4 (JHU)
8678901850655AA228549KJ4SLB375T3JHU93SL-BmL4 (JHU)
8808411870825AA241476MBL2SJ0C4T3Brugia malayi second stage larvae JHU96SL-BmL2
8981821892787AA257265MB4SLM1B8T3Brugia malayi L4 JHU93SL-BmL4
8982281892833AA257357MB4SLM1H5T3Brugia malayi L4 JHU93SL-BmL4
8982361892841AA257365MB4SLM2A5T3Brugia malayi L4 JHU93SL-BmL4
8982491892854AA257378MB4SLM2B8T3Brugia malayi L4 JHU93SL-BmL4
8982551892860AA257384MB4SLM2C4T3Brugia malayi L4 JHU93SL-BmL4
8987811893386AA257870MBL2SJ4E8T3Brugia malayi second stage larvae JHU96SL-BmL2
9164921917112AA275531MB4SLY1H12T3Brugia malayi L4 JHU93SL-BmL4
9165551917175AA275527MBL2SK1H11T3Brugia malayi second stage larvae JHU96SL-BmL2
11887342289598AA542686MB4SLY2B01T3Brugia malayi L4 JHU93SL-BmL4
13870682663008AA681003SW3D9CA524SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 13:34:47 on Fri 24 Nov 117.