CBrugiaQ_1682


Sequence

>CBrugiaQ_1682 (2 EST) Length=434 AATTTCCCAAGAATGATATTTCGTTATGCTTTTCGAAGTTTATGTTGAAGAAATCTAAAAAACATTGGCCAAAAAGTCGG ATGGAGCATCATAAATATAAGGGAAGAACCGAATTCATGAGATCAGCAGCCTCACCTTTCTCTCAGACGTCTGGAGGAAA TAATTGTTATTTGAATGGTTTTCACATTCACGGGATCGGAGAAGATACACGAACTTCTATGATTGTCGAGATATGACGAC CAGAGTGGGAGATGAAATATGCGAGCGGCCAATCAAGTCCTGCTTCACAAAAATTCATAAAAATGTTGGGTTGATTGTTA CCAAAATCATAATTCCAAATACCACAGTTATCCCTGGTTTTTTGCGACGTTGATGCATGAGGGACTAGGAATTAAGTTGG CATGAACTTTGACGCATTATGGACAATGAAAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1682: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5305121300262W23399RRAMCA1284SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5406761313854W32824RRAMCA1138SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:3:29 on Sat 18 Nov 117.