CBrugiaQ_1705


Sequence

>CBrugiaQ_1705 (2 EST) Length=685 TATTAAATCATCCACCGTTTCACATGCTTCCTTCGGTGGTCGACGAGGAATCCGTAATCGGTCACCATATTTTTTATACA ACTCATCCATTGAGTGAGCGGCATTTATGGATTTTACAACGACTTTCGAATTTTCCAAATCAAGCATACGAAATTGTTCT CTTTCGGCTGCAAAATTCGTTCCAGCAAGCTCCGCTTTGGCCAGAAATTCTTCCAGACCTGTTTCTTCGATTACGGAGTC GACATTTTGTGCCACATTCTTGTCAATTTCAATCATATTCTCAGTGTTATAAGCTTGTTGTCTTTTCCGACATTGTTGAC GTAATTTTTCACGCTCATTTAATAAGCAATTTCCTAAAGAACGATTCAAACCCGTTGGTTTTTTGTTTTTTGGCCGGCGT TTTGTCACTCGTGCCGAATTCGGCACGAGGTCAATTCACCACAACACAAGTTTTTTGCAGATGGCCTTCAAGTGTTTATT CATATGGCTTTAAAAAAACCTCAGAAAAATATTGATAACAAATTGCTTATGTCAAAAATTGAGTTTACTGAGAGTATTTG GGATAGTAATCCTCTTTGATACAATTGTCTTCATTAAGTTTTATTATATTGTTAGATTTTTTCTTCGTTGTTTGGGAATT TGAAATGAAAATTTCTGATGTAAATTCGTATGGTCCTTCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1705: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003151737698AA161668MBAFCG0E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669322605470AA661426MBAFCW3H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:1:36 on Fri 24 Nov 117.