CBrugiaQ_1717


Sequence

>CBrugiaQ_1717 (2 EST) Length=441 CAAAGGTTGTTTTTGGACAGNTAAAAGTAATCATCNAATCGTCCGGTATGGCTTCAGGAAACAGTTTCATTTCGAGTATG CCGTCGGGAATGTTGATCTTTTGGATGATTTGGTACTTTTGGACAATCAGCCATGCATCGAAGCACAGCCAATACCGTTA GAATATCGCATATCGTTTAACACGAACTTTGAGGACCGAAATGCTTACGTGACAGGTGTTTCCAAGTACATTGAGGAAGC CACGCGACATGCAGAATTTAATGGCATGTTTATCAGAAGGTTTTGAGCATGCTGCTCATTTGTATACCTGGCGATGCTGT TCACGAGCTGTTCCTATGGCAAAATCTAATGACCAACCGAATCGAGTGGAAATAAATGAAAAAGTTGTTGAAGTATTGAA TCCTGAAGTGGAGAAATTGCACCGTTTTATGCATTTTGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1717: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8249211769750AA185862SW3ICA1968SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11539842247198AA509321MBAFCX9H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 5:13:15 on Sat 18 Nov 117.