CBrugiaQ_1721


Sequence

>CBrugiaQ_1721 (6 EST) Length=412 ACCCAAGTTTGAGTGAGCAACAATGAGCCTTGCACCATTCTTCGATAAAGCACCTTCAATAATTAATAAGCCTGATGGTA GTGTACTGTTCGAATGCATGTGTAATGCGAATCCCGAACCAACCATACAATGGTTTTTCAAGGATAAGGAATTAAGTGGT GATCGATATACGATGAAAATAAAGAAAATGGTTGGCAAATGGACATGCACGATGACCATGAAGAATCCAACATTGCAAGA CCAAGGAGTATATAAAGTAGTAGCGACGAACAAGAATGGTACCCATTCAGTGGAACAAAATTATGTGCTATCATGCACCG CTAATGAAGTTTTCAAAACTCAATAACTAGCTCATGATTCTACTTTTCAATACTTTTTAATGTCAGTTTAAAATAAAACG AAGTAAGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1721: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217653808475R47588AS3ISA017SLBrugia malayi infective L3 JHU93SL-BmL3
217784808606R47719AS3ISB113SLBrugia malayi infective L3 JHU93SL-BmL3
5594721345293W51580AS4SLC771T3Brugia malayi L4 JHU93SL-BmL4
8982581892863AA257387MB4SLM2C9T3Brugia malayi L4 JHU93SL-BmL4
9101171906182AA269120KJ4SLB092T3JHU93SL-BmL4 (JHU)
9164371917057AA275422MB4SLY1D02T3Brugia malayi L4 JHU93SL-BmL4


Date: 7:28:5 on Sat 18 Nov 117.