CBrugiaQ_173


Sequence

>CBrugiaQ_173 (2 EST) Length=687 CTGCCGANCACATCATCTCAATACCTGCACTAGAGGGCATAAGANNGAAATAAATTGTTAGCATCTTCGAGAAATTTCCC GAANATTTTGAAAATTTTCAANCTGCGAGAATGAGTCAGTGTAATANGCTCATCGACAAGGATGCCGATGCAATCAGGAA AAGATGTGTCATTACGCAGGTACCATCAACCAGTGCTTCATCGGTAGATGCAAAACTCTCAGTTCCATCATTACGAGGGC GTGCTGGACAAAGTAAGCCGAGTAGTGTCGTTAAACAATTCGAATACGGAATCTGTGGGGCTAAGTTTAAATGATAATGA TAAGTTCTGAAGACACTCAACCGCTTTGGGCAATACAGATGTGACACTCAAAACTCCAACTGTGCTTGGTTCACCCACTA ACAGGACCGTTTTCTGCCGGCACACATGTTGACGAACTCATCACTCCCAAACTCCAGCTTAAATAACTTCTCTACACCAA AATATTCACACACAAGCTTTCTTCGGTGAACACGAACCAACTCCTCACCGGCAAAACATTGGAGATTTCAACAGTCTTGC CGGCCAGTCCGTCGAATAGCTAATGGTGACACCAAGCGGCTACAACAATTGGGACCGAAATGGAAGCCTCAAAATTGATG TTTNGAGAATCAAAAAGGCTNCGAATTACCCTTCCAAAGGAAGCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_173: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141461912516AA273142SW3ICA2567SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11919292307171AA545880SWMFCA2429SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:34:38 on Fri 24 Nov 117.