CBrugiaQ_1735


Sequence

>CBrugiaQ_1735 (2 EST) Length=397 GATTCGGCACNAGGTGGTGTCAGATGAAGAATGATGCATTCTGCCGCGCTATTGTCTCAAAATGTTCAGACCTTACGATT GTTGAGTACCAGTGTTCCGCAACAGTCTATCAAAACTCCAATTCAGGAATGGGGTTGGAATTACCTTTTGCGACAACGGG CTTTGAAGCGACCGATCAGCCCACATCTTGCGGTATATAAACCACAGGTCACATGGATGGTTTCCGGATTTCATCGTATG ACAGGATGTGCTATGGCTGGTACTCTGTTGATTGGTGGTGTCGGTTTTGCTCTGTCGCCATTGAACTTCACCACTTTCAT TGATTTTATTCGTGGTCTTGGGTTANCCGTGGGTTATAACTGATATNTTTAAATTTATCATTGCTTANCCNATCNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1735: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002121737595AA161585MBAFCF1E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8865191878431AA247102SW3ICA2210SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:8:29 on Fri 17 Nov 117.