CBrugiaQ_1741


Sequence

>CBrugiaQ_1741 (2 EST) Length=427 ACCCAAGTTTGAGGAATTTTCGATTGCTTATTATGTTGCTATTTGTTATCACTAAATATTTGATTGCTTTAACAATACCC ATAATGCTACTATCATTTGACGAAACGAATGCACAGTTACTCAATTTAAACTTTTTGTCATTTAATAACAACAGAGCAGG CGACAACTCATTGAACGGTAATGGTAACGCAGGTGCTAGACCCGGTGCTGCTCCAGCTAATCAAGCTAATCAAGCAAATC AAGCTCAACAAAATCCTTTTGGCACATGGCAATCTGCTCTTGGTGCTGGCCTAGGTTTCCTTGCGGGTAGCTTTCTTAGC AGAGGCTTGTCTTCATCATCATCATCATCATACAGTTATTACCCTTACTATTCATACGGCAGTTATTATTATCCTTATAA CAGTGGGTACAGAGGGAATAACTACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1741: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449661172348N43465AS4SLC793T3Brugia malayi L4 JHU93SL-BmL4
10987722167942AA454273RRAMCA416SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:22:18 on Fri 24 Nov 117.