CBrugiaQ_1746


Sequence

>CBrugiaQ_1746 (6 EST) Length=447 AATTCCGANAAAATTTATTAGTGCGAATACAATAAAATGATGAAACGATGAAATAATAATCTAAAAAAGATTGATCAGAT CATTAATGATCTTTTCTTCATCGANTCGATCTTTTATCATTGAAATTAAGTTGGTTCCGTTTTACAATCGCATTGTCCTT TATAATTGTCACAGTCTGGCTCACCTTCCAATAAGCAATGCCAAAATTTCTTGCATTTTTGATTGCATAATGACACTCTT CGTCCCATTGCATTAGGCATAGCGATGACAATGATAACAATTAAAACGAGCAATTTTGTTGTATTCAACATATTCTTGTT GAGTTTTAATATCGATCAATTCAACGTTGAAATAAAATTTCCTGATCAGTTACAATTAAGAACTGAATTGATCACTTATT AAATCAAGCAACCAACCGGAATACTTTTCACGCTCTCGTGCCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1746: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217636808458R47571SWAMCA072SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320260945461R86434SWAMCA419SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5072391271723W00309RRAMCA1120SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304591300209W23355SWAMCA503SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807241547287AA054880RRAMCA240SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807271547290AA054883RRAMCA250SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:17:48 on Mon 20 Nov 117.