CBrugiaQ_175


Sequence

>CBrugiaQ_175 (5 EST) Length=685 CCGAATATAAATACAACTATAACTCTTACATAAATCAAATCATTCAGTCTAATTAAAGTATTAGAGAAAGAAATCTTATT TCAGAAGCTATAGAGAAAGTACCGCAAGGGAAAGATGAAAGAATTACAACTTATAGTAAAAACAAGCAAAGATTCCCCCT TGTACCTTTTGCATTATGGATCAATTAGAACTATACTAGCTAAGAGGACTTCAGTTAGTATTCCCGAAACCAAACGAGCT ACCTAAGAACAACTTTATGAGTTAACCCGTCCATGTGACAGAATGGTGGGAGGATTTTTAGGTAGAGGTGAAAAGCCTAA CGAGCTTGGTGATAGCTGGTTACCCAACTAATGAATTTTAGTTCAACTTTAAGCCTACCCCTAGAATTTACAATCCCCAT GTAAGCTTAAAAGATAGCCTAAAAAGGTACAGCTCTTTAGGCCAAGGATACAGCCTTTAATAGTGAATAACCAAAATACC AATAAACCATAGTTGGCTTTAAAGCACCCCCCAATAAAGAAAGCGTTCAAGCTCCAAATTTTAAAATTTATCCCAATTCC CAAAAGAAACAGTAATTCCTAACTCCCTAATTGGGTTAATCTATTGAAATTTAGATGAAACCATGTTGACNTGAATTACC AGAATATATCTCCCGCCCCNGCTATACACCGATACATGTTAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_175: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939381081927H91497SWMFCA081SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722671537214AA052036SWMFCA755SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8713691855025AA231984SWMFCA1379SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855841876988AA246076SWMFCA1668SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212732345170AA570877SWMFCA2642SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:12:3 on Sun 19 Nov 117.