CBrugiaQ_1752


Sequence

>CBrugiaQ_1752 (4 EST) Length=410 GAGTAAAAATTTTTATTTCGTTCGGGATGATGGCAAAAAATTCATGCAGCAGTAGTAATAACATTTGATACTTGTTCAAA ACATAGACTAAAGATAGAGTATGTCATTTCCTAATTCACACTTTTTGTTCTCAGTTTCACAGTATTCCCATGTCTGTTTA CACGAAGAAGGAGAAGAAGAGCGAGCACCACTGCGCGTTCATGATCTATGTATGCTTTCCAGTAACGGCCAGCATTCGGA AACTGCTTCACTAATTTCTCGTAAAACGAACGCACCTGATCAATTGGTCTAGCCTGTGACTCTCGCAGCAAAAGATTCCA GGCATCGACATCAAAAGGATTAAGTTCAATCCGACGTTCGGGACTTACAATCGAAAGCGAACTCATCGATGACTCAAACT TGGGTAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1752: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435320
4449361172318N43435AS4SLC587T3Brugia malayi L4 JHU93SL-BmL4
4576391193276N52110KJ4SLB172T3JHU93SL-BmL4 (JHU)
13813512655471AA675765MBAFCW4E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:53:11 on Mon 20 Nov 117.