CBrugiaQ_1771


Sequence

>CBrugiaQ_1771 (29 EST) Length=690 ACCATCCAGTTAGGCCTAGAGCTAACTCCATATATACGAAAGGTGATGGTTTGTCAGCTTCCAGCTTCAGCTCATACAAC ATATCATTTTTCCTCTGCAGTTCTCGAATCCAAACTTTTCCGAAATTCACTTCATCTATCTTAAACAGCTTATCAGGCAA ATGAACGGTATCATAACCAATTTGAGTACCATTATTTGACAACAACCTTCCTCGCAAAATGTACTGGTTATTTCTCTTCC TTATTCCGTCGGAAATGGCTTCATCGATAGAAATTTCAGTAGATGACTGCGGAGGAATTGAACTAATTTCTCGTTTAAAT GAGTAAACTGGAAAGAACCCATCAAACCAGAAAACTTCCAAGACCACTGTTGCGTTGGATATTGGTTTTATTAGATCTGA TATAGCGAACATGTGGACGTTTTCGTCTCGTGCCGAATTCGGCACGACTAGTGTTCCATNAGTGTTCCAAAAAAACAGCG GATAGCGTATGGTTGAGTGCTGAGTTAAAAAATAAAAATGTGTCTGCATCCTCCCGAGCCAAAAAAAGTGAAAAATGACA AAAAAAGACACTCTCTAAAAAAAAGAAAATTGTTAATTGACAAAAACAGAAAAAAAAAATTGTAAAAACAAAACTTGCGA AAAATGACAAAAAAAAACACTCTCTAAAAAAAAGAAAATTGTTAATTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1771: (29 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3658241019997H64236RRAMCA045SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5076941272178W00763SWAMCA564SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6186061463707AA007702SWAMCA789SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7244581631368AA088141SWAFCA001SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7271801634825AA089346SWAFCA079SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7472041660814AA109318MBAFCE0G09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472921660902AA109301MBAFCE2A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522791668263AA114380MBAFCE3D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522861668270AA114387MBAFCE3E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619841681852AA123541MBAFCE7F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001921737575AA161565MBAFCF1B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002071737590AA161580MBAFCF1D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002751737658AA161628MBAFCF7D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003001737683AA161653MBAFCG0C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003221737705AA161675MBAFCG0F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195871763768AA180550MBAFCF7E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195941763775AA180557MBAFCF7F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196051763786AA180581MBAFCF7G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196361763817AA180625MBAFCG1C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196401763821AA180629MBAFCG1C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196891763870AA180587MBAFCG2F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197201763901AA180683MBAFCG3B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197471763928AA180710MBAFCG3F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197591763940AA180722MBAFCG3G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197601763941AA180723MBAFCG3H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197621763943AA180725MBAFCG3H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985251893130AA257653MBAFCZ2E3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161152199256AA471492MBAFCX3B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669252605463AA661419MBAFCW3G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:22:35 on Tue 21 Nov 117.