CBrugiaQ_1774


Sequence

>CBrugiaQ_1774 (2 EST) Length=544 CCGAACTGCTTTTATTCTATAGCTTTTACTTGTTTCAGTTTTATGTCGAATTTTATCTATTTGCTCCGATACAAGAATGC AAGTCCTTATTTCTTTTGTAGAAAATTTGAGCTTGTCATATTTTGTACCTCCTTATGCTATTTTGCAAACACATCGTCTT TCGGTTACTTGATTTCGACTACATGTGGAATAAGCATTGCTGTCTCTAGCCACTTTTTCTTATTGTCACAGCGTGTTTTC CTACGTTTCTTTCATTTAACGAGTCATTTATTATCACCAAATCCCAAAGGATTTTCCATAATTTTAACAAGTTATCAGCT TGAACTTCTAAGCCCACAGGTGTTATAGGTTTCAAGTTTAATCAGGAGTTAATCAAGCTAGTACTGAGAAATGTTGCAGC GTGTTTTAAGGGACAATGAGGCAATTACGAAGATCGAGAGAGCCAATCTATGAGTCTTTTGGGAGACTATAATAAATTCG TGCATCTTTTTATGTNCTCAAAATCTATCTTACTGTTATTACTTCCAAATGAAGCTTGAAGTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1774: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446131167414N43109SW3ICA944SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7092421613916AA074012SW3ICA1667SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:19:3 on Mon 20 Nov 117.