CBrugiaQ_1776


Sequence

>CBrugiaQ_1776 (2 EST) Length=410 GCTATGCCGGCAGAAATTGCACCTGCAGTACAAAATCCTAATTCAAGTTCTTTTCCAAATAGTGAAAAGAACGTGTGCTG GTGTGTTGAATGAAGTGAAAAAGGAAGATATGTCTAATGACGAAGATATTCCACTGTCGCAGAAGGCACGAAGGGTTATA GATGACGATGATATACCGCTCGCCAAAAAGTTGAAAACAATGAAAGATCCACCTGATGATGATGATGTACCATTGTCAGA AAAGGCTAAGCCACAGAAAAGATTATCCGAGGTGATGGGTACTGCATCGAGTAGTCGAATTAAAAAGCCATTGTCATCAT CCGCCCCTTTCGTCGACAAAAAAAATGCTTAAAACAGAACTGGAAAGTGATGATGATGTCCCATTGAGCGTGCGAGCTGC TACATTGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1776: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217702808524R47637AS3ISB018SLBrugia malayi infective L3 JHU93SL-BmL3
281223889980H21285AS3ISB221SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 17:14:46 on Fri 24 Nov 117.