CBrugiaQ_1778


Sequence

>CBrugiaQ_1778 (3 EST) Length=617 ATTATGAAAAAAGAAAAGTCTGTGGTAACTATTGGATCATTTGGAATGGAAAGTGAAAAAAATGCAATCGAAAGACATCG GAATGAACAAGGCTTAGGATGGATTATAACAAGTTTTGTGGTCGTCGGTGATTTAGCTGGTGGCGGTATTGTCGCTTCAC CAGCAGCTATTGTGCAAACAAATGGGGGGCCTGGATTAATAATGAATACAATGATGGCTTTAGCAATGACATATACAGCG CATATGTTGGGCCTTGGCTGGGCTATTTTGCAGCGCAGATGGCCAGAATATAGGGAACATTGTCGAAAGCCATATGCTGA AATGGGTTGCACGAGCAATGGGTTAGCACTGTAAAGCATGTTAGTATCAGTTATGCATTGACATAACACAATTTGGTATC CCTGTTGTTTACCTGATATTATCAGCTAAAAATATAAGCGATTTTATTGATGCATTCTTCACAATTGAAATATCACTCCG CTATGTGATATTAGCAGCTGGTCTTTGCCTTCTACCTGTTACATTCCTAAAATCTCCACAAGATTTCTGGTGGGCTATAA TATTAGCAATGATTACAACAGGTGCTGCACTAATACTGCTCTATGATCTGGCGCCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1778: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447711167668N43286SW3ICA755SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6378841488483AA023867SWAMCA1057SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9139761911900AA272973SW3ICA2468SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:57:17 on Mon 20 Nov 117.