CBrugiaQ_1795


Sequence

>CBrugiaQ_1795 (3 EST) Length=565 TCCGGAAAAGAAATGACCATCCTGTGGCTCCGAATCTTGAGTTCCATTTAGATCAGAATCGTTCTTCAATAGGCTCTAAT TTCCATATGTTTTGCAAACCGGCCATTCTTGTCTGTAAATTTTTCAACCATATTTGCTCGTTGGCCAACCATTTCGATTT CACATCATAATAGAAATTTTTGTATTCATTCATCCGTTTGTCATCCATTTTGATCCATTCCGGTAAAGAAAGTTCTGGCA AATTTTTCTTCCACTCCTCATATCGGTTACTAGCTGCAACGGAACCGCTAAAAACACCAGCTGCAACCCAATATCGCAAT TTCAGTACTTGGCGAAGCACAAATCTTGCAAAATATCTTTCGCCTCGAAAATTTTGCCCTTGCTTAAACAGAAGTCTTTT TTTTGCTCCAAACATAGAATATGGCCGTTTCACAGGTTGAAATATATTAATTTCTCTTCCGCTTAACACTGTCATTACTT ACTTCATCCGACATTCGTAGGTTACCATATGTNGTAGTAATCCGTAGACTACGACACCGCAGAGAAGATGAGATGAGCCA CCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1795: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7092311613905AA074001SW3ICA1655SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7472091660819AA109349MBAFCE0H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482352064882AA406812MBAFCZ6E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:59:20 on Sun 19 Nov 117.