CBrugiaQ_1797


Sequence

>CBrugiaQ_1797 (3 EST) Length=458 CTTTTTTTTCTTTGTTTTGGAAGCTAAGAAGTACAAGATTTTTTGATTATAATTGGCAGCTCTATCTTTTATTTTTCAAT AAAAACCATTACCTGGTTTCTTTATTGTAATACACACCTCATTTCTACCAACACCACAATCTACGGTTTTGTATTGGTCG GTTTTAATTTAGGCTATTATGCTAATGATTTTTTGTCATTGTTTTTATGAAAGAAAGAGTTCCTTTTCTAATCTAAGGGT TTCAGTTTTCTTAAATTGTCTTCGTTCTTTTTGCAGTTTTGATAATTCTTTTACTTTTTATTGTCATATTTCGCCAGCTC TTATTGTCTAACAAATTGACCGTGGCCATTGTTATTGTTGTATGAGAATGTGGATGGTTTAAATCAAGTTTGCTTCATTT TACTCGAAAAAAAAAAAATCTCTCAAGCATAAATATTACGCACGCCTTATAGATTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1797: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425661164714N41116SWMFCA292SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11538522247066AA509189MBAFCX8C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668922605430AA661386MBAFCW3D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:29:46 on Sun 19 Nov 117.