CBrugiaQ_1805


Sequence

>CBrugiaQ_1805 (5 EST) Length=849 AATTAAAATTTTGGCACCAATTTTTTTTTTTTGTGTCACATCAATTAACTCGATTTTGTCTTATCATTATTATCACTTTC AGCTGCAATATCATATGCCTTCTTGATTTCTTGCAATTCGGGCACCACTTCTTTCTTCAATAAAACTAATTAATGCATTA ACTTTTGCTTTTATAGCTGGAATAGCTTCATCATTAATCCAATCCTGAATACGTCGATGTGTTTCAGGGTCTTTTAGTTT AGCTTTAGCGTCATCAAACGTTTCACGTACCGTTGGAGCGGCTTTATCTTTGATATAATCAGCACCAGAGACAAGCTTAC TATGTAAGCCATTTACTAAATCATCAAACCAATCTGCTTCCGTGAAGCATAAAAGTGTAGTAAACGTAATAAACGTGTAA GTAGTGATGCGTAACAATTGCATTACTCAAACTCGTGCCGAATTCGGCACGAGGCTACATGAAATGTACATTATGCGTGA TCGATTATCTGCAACGATAGCCGAACGATCTAATTCGATCAAAGAAATGTTGGTACGAGCTGAAGATGCCCGAACTATCA ATCAATTCTGTTTAATGAGTAAATATTATCAGAAGATGCATACGTTAAATCAGGGCATGGTAGCAGAACATAAAATACGT TGTAATAATCATGAAGAATTGCTTAAACTTCTTCGANATCTTAACAAAATTATTGAACAAGGCTCTCGACTTCGAGTGGG TGCACCAGCTAGTCGATTAATTTCAGCATGTCGAGATGCAATTGTTCAGGAACATNTTGATATGCTTCAAAAAATTATCC TCTTTGGTGTATAACATGTAAAACAAATAATAATAAAATATCGCTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1805: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644771017404H63058AS3ISB138T3Brugia malayi infective L3 JHU93SL-BmL3
8983731892978AA257502MBAFCZ0G1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984751893080AA257604MBAFCZ1H1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813042655424AA675718MBAFCW4A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813992655519AA675813MBAFCW5B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:11:38 on Wed 22 Nov 117.