CBrugiaQ_1809


Sequence

>CBrugiaQ_1809 (4 EST) Length=510 TCAAAAATGCTATGGTTATACTTGCTGAGGGGGCCGAGGAAATGGAAACTGTTATTCCCGTTGACGTGTGGAGACGAGCT GGAGTTGAGGTTACTATTGCTGGTCTTCTCGGTAAAAATACAGTGAAATGTTCGAGGCAAGTGATGATTACGCCTGATAA AGCTTTATTCGAAGTGGCAGATAACAAATTTGATGTTGTGATTTTGCCAGGTGGCTTACAAGGGGCAAATTCCCTTGCAG CATCAGACGAAGTGGGCACTATACTTCGAACTCAGTACGAAAGTGGTCGTTACATAGCTGCGATATGTGCTGCACCGATT GCCCTAAAAAGTCACGGTATTGCCCCAGGGATATTGCTGACATCACACCCAAGTGTTAAACCAAAACTTGTGGAAGGAGG ATACAAATATTCTGAAGATCGTGTGGTTACAACAGATCATATAGTCACTAGCCGTGGCCCAGGAACTGCATTAGAGTTTG CATTAAAATTGGTCGAGTTACTTGTTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1809: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427201164868N41270SW3ICA664SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447891167686N43304SW3ICA851SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10988092167979AA454310MBAFCX0A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161372199278AA471514MBAFCX3D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:4:50 on Sun 19 Nov 117.