CBrugiaQ_1819


Sequence

>CBrugiaQ_1819 (3 EST) Length=422 TCTAAAACTATTGGATCCCCCGGGCTGCAGGAATTCGGCACAAGTTTGAGTTTTTCATTAAAATGGAATCGGAACTGGAG AAATTGGCTGATGAAATGGTGTCAAAGGAACAAGTGAAGGGGGTGCTCTGTGCTGATGAATCAGGCTTAAATGTATGTAG CCGTGGAACATTGAGTAATGCACCAGGTGATGCAGCGGTTGATTTATTGAAACTTGCTAGCAATTTGGAGCCGAATTTAC CTATGTCTTCCATTGTCATTGAGCTTGCAGGTATTGATGGAAGTGTACTCTCCATAACAAAAGAAGGAGTTTTAACAACA GCGATACATCGCACTGATAGGAAGAGTCGTGATTTTGATTAGTTCTGATAACTTTAGTTCTGATATCCCAATAGATTGAC GATTTTTGTATTTATATTTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1819: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5305151300265W23402RRAMCA1288SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10988692168039AA454370MBAFCX0G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163432199484AA471720MBAFCX5G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:25:53 on Sat 18 Nov 117.