CBrugiaQ_1829


Sequence

>CBrugiaQ_1829 (2 EST) Length=429 GGCCTCCCTTGAAGTACGATTAAAGAGAGAAGATAAGGTGAATGTGAAGAAAGGTGTATTGGTACGTTGTGATCCTGCAA TGCGTCAATTGCTAGTGTATCTCGATGAGTCACGTACGTTAGGATCAAAGTTCGTGGTGAAAGAGCTGGACGAAACACAT ATTTTGGGTCGATAAAGAAATTGTACCAATTCCTGAACAGAAACTTGATCAAATGATGGAATCACTCTCACCTGATCTCA CCGACAAGTAAATTATATCCTCTCTCTCACTCACTCTCAGTCCAGGTATTTCGGCAGCTACATTTCATGGCACAGTAATG TCTAAGCGTACATTTTCATGCCCAATGTTTCGGGATGAACAAACCCATATAACCTTGGTTGTTATGTAGAAATCTGAAGA TCAGCCCCTNGCCNATTGCCACTTATTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1829: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217717808539R47652AS3ISB057SLBrugia malayi infective L3 JHU93SL-BmL3
8981701892775AA257286MB4SLM1A6T3Brugia malayi L4 JHU93SL-BmL4


Date: 19:37:1 on Fri 17 Nov 117.