CBrugiaQ_183


Sequence

>CBrugiaQ_183 (5 EST) Length=681 GTTAACAGGGAGAGAAACTGGACAAATGAGCAGTGACGGAAATCGCAGTGAATCAGCACCTGCACGTAGTGCGTCACGGA GTCGAAGTGGCACACCGATGGCCTCAGGTAAGAGTAATGGCCATGCTCGATCTCCCTCGGGCTCTCGACCCCGTTCATCA TCTCACCATTCACTATCTCAATCACCAGTTCGTGAACGTTCAGCTGCTTCGCGATCGTCTGCTGGACACGAAGCTTCCAG ATCTCCTTCACGCGCTCGCTCAAGATCACGCGATGACAGACGTGTTCGCCGCTCACGCTCACCTGAGGGAACGAAAACGA TACCGATCGCGCAGTCGTGACTCACGATACCGTCGACGAAGCCGATCACCATCGTCGCCAGCTCGTCGGCGCTCTCGTTC ACGTCGACGTAGTCGCTCACGTTCCCCACGTCGTATCAGCCGCTATTCACCGATAAGACGAAGTCGGTATAACGACGGTC GTGACAATCCAGAAACATGTCCCTGTCTTGGCGTTTTTGGCATGTCACTTAATACTACTGGAACGTGACCTTGAAAACGA ATTTTCGGCGAAATATGGGGGANATTGAATCNGTTCAACTAGTGTTACGATCGCTACAGTGGGTCGCTCACGTTGGTTTT GGCNTCGTTTACTTTGAAACTAACAAAGGAAGCCATTCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_183: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186271463728AA007723SWMFCA395SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6186411463742AA007737SWMFCA418SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6186421463743AA007738SWMFCA419SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7620431681911AA123600MBAFCE8D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11918912307133AA545842SWMFCA2364SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:41:48 on Sat 25 Nov 117.