CBrugiaQ_1831


Sequence

>CBrugiaQ_1831 (34 EST) Length=824 TTAAACATGAGAAATTTTACTGAACGCTAACAAAATAAACAACAGATCGATTCAACTTGCAACAATTCCTTAAACATTTT TCTCCTCGGAAATGGTTTCTTCGGTATGTTTACCCTTCAACAGGCCTGTTATACGTGCTCGCCCGGCAGCTTTTCTTTCA ATCATCGCTCGTCGATCCTTATCCATCTTTAGTTTTGTCAGCGCTACCTTGGATGGATGGATTCCAATATGTACTGTAGA ACCATTTGCTTTTTCACGAGTAATTTTATCAATGTGGATAACGAATTTTTTCCGGTAAACACGCATTACACGCCCAGCGT TTCCTTTATAATGTCCTCGAGTAACGGTGACTTCGTCATCTATTCTGATCGGTATTGAACGGATCCCATGCTTGTTACGT AAATCTTTGGTTAAAGGAGCACTCATCAATTTCCTCCTAATATGTGAAGGAGCATTGAAGTGTGCCTTACGAGCTTTCCT AGCTGAAGACGACACGAACTGATTTTGCTTCATTTTAATTTGAAGACCTCAAACTTCGGTGCCGAATTCGGCACGAGGCG GACGTCAATATTTAGGTTTCGTCTCCTACGACAATACCGCCTCAGCAATGGCAGCAATTCAGGCAATGAATGGCTTCCAA ATTGGCATGAAACGACTCAAAGTGCAATTGAAACGACCTAGAGATAAACCGTACTGAGCAAAAATGAATATAGTTCAAAA AAAAAAAAAAAAAATTTTAAAAAAAAGGGGTGGGGTTGGTTCAAATCTTAAGAAAAGCAGATTTGGGGGGGTTTTCGTAA TGTTTGGGTTTCCTTTGGCNACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1831: (34 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435281
1435302
217685808507R47620AS3ISB013SLBrugia malayi infective L3 JHU93SL-BmL3
4448811172263N43380AS4SLC460T3Brugia malayi L4 JHU93SL-BmL4
4449081172290N43407AS4SLC536T3Brugia malayi L4 JHU93SL-BmL4
4809921236229N74830RRAMCA1101SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5595241345345W51544AS4SLC924T3Brugia malayi L4 JHU93SL-BmL4
6001141420952W91868RRAMCA191SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6837931550552AA057912SWMFCA912SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7062181592636AA072535MB4SLD054T3Brugia malayi L4 JHU93SL-BmL4
7159331620790AA080695RRAMCA260SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7471881660798AA109262MBAFCE0E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7496781663682AA111792SW3ICA1886SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7619711681839AA123515MBAFCE7D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8557841817187AA216483AS4SLC652M13RBrugia malayi L4 JHU93SL-BmL4
8558081817211AA216471AS4SLC733T3Brugia malayi L4 JHU93SL-BmL4
8558091817212AA216472AS4SLC737T3Brugia malayi L4 JHU93SL-BmL4
8675311849761AA228203SWMFCA1128SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981801892785AA257263MB4SLM1B6T3Brugia malayi L4 JHU93SL-BmL4
8981811892786AA257264MB4SLM1B7T3Brugia malayi L4 JHU93SL-BmL4
8981861892791AA257289MB4SLM1C1T3Brugia malayi L4 JHU93SL-BmL4
8981881892793AA257291MB4SLM1C3T3Brugia malayi L4 JHU93SL-BmL4
8981981892803AA257301MB4SLM1D5T3Brugia malayi L4 JHU93SL-BmL4
8982561892861AA257385MB4SLM2C5T3Brugia malayi L4 JHU93SL-BmL4
8985481893153AA257676MBAFCZ2G5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9101031906168AA269106KJ4SLB014T3JHU93SL-BmL4 (JHU)
9101071906172AA269110KJ4SLB030T3JHU93SL-BmL4 (JHU)
9164261917046AA275411MB4SLY1C03T3Brugia malayi L4 JHU93SL-BmL4
9164281917048AA275413MB4SLY1C05T3Brugia malayi L4 JHU93SL-BmL4
9215001923351AA280490SWMFCA2181SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10480292064676AA406684MBAFCZ2G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482492064896AA406891MBAFCZ6F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11939072315059AA547858MB3D6V2A02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12617442392940AA585528SW3D9CA106SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:42:31 on Sun 19 Nov 117.