CBrugiaQ_1838


Sequence

>CBrugiaQ_1838 (6 EST) Length=532 CNGCAGGATTCGATATCAAACTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTC GTATTACAANCGCATTAACGAAATATAATTGGTAACCCCTTGAAATATCATCCGTAATACTGGTGATCNGGAATTGCAAT TATTTCCCTTGAACGAGGAATTCCTAGTAAGTGTGAGTCATCAGCTCACGTTGATTACGTCCCTGCCCTTTGTACACACC GCCCGTCGCTGCCCGGGACTGAGCCGTTTCGAGAAAACCGGAGACTGCTGTTTCAATACCTTTCAAGGGTAGAGATTCTT TGGTGGAAACTGCTTTAATCGCAGTGGCTTGAACCGGGCAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGG ATCATTATCGTGCTTCTAAAAACAACAATAAATAAAACAATGATTATTAATTTATTTATTATACTACCATATTATTTTTG CTATATTAGTAATAAAACATATATGTGTTACTAATATAGATTGATGTGAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1838: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7471441660754AA109336MBAFCE0A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141101912480AA273106SWMFCA1934SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11938492315001AA547800MB3D6V1A09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12618562393052AA585640SW3D9CA378SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870672663007AA681002SW3D9CA523SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870712663011AA681006SW3D9CA532SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 1:19:56 on Tue 21 Nov 117.