CBrugiaQ_184


Sequence

>CBrugiaQ_184 (2 EST) Length=680 GTTTGAGCTATTTGCAATATGGTATTGCTTTTGGATGAAAAATACTCACCAAATGATTGTTATAATTACACATCATCAAC GTCAACGTCAAAATTAACGTTAACATCAACAACATCATCATCGTCATCATCATCATCATCGTCATCATCATGTTCATCAT CAGAGTATGATGGTGATGAATACGATAGTGATTTTTCACCACGTACATTACTGACAATGGCAATTCAACGACGTCGTATT ATTTACAACAGTAAAGAGCGTGATCTAAGACGAGAATTGCTGCATACAAGTTTCATTCAATCGTTATGTAAATACCTTGG TGAACGTCGTGCGAAACGACACCAACAACGACGTGCTGCCAAACGTCATCGTAGGAGGAACAGTCGGGAAAGTCGGAAAC TTGCCTTTGTCGAATGTTATGGAAGCTGAGAGCACAATGATTGAAGCACCACCACCACCGCCGCGGTCTGTTTCAAGAAA GCGCGATATAGTCAGTCGGATGCGGATCCGTTTGGCTTAAAATGCCTTATTCGAATGAATTATTTGGCCAAACAGTTGTT GCGTTCGGGTGGGTTCCAACCTTTTTTTTAAATATTTGGGTCGTTTGGCTATGTTGAATCACCAATTCCGAAGCCCGTGC GTCTCATTTTTCGGATGTGAAATCCGAAACTCGAGAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_184: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944611887886AA253537SWMFCA1429SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981331892738AA257210SWMFCA1503SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:44:50 on Wed 22 Nov 117.