CBrugiaQ_1840


Sequence

>CBrugiaQ_1840 (118 EST) Length=2646 GAGAATGTGGCATTGTAACTTATTAATACTGCTATTGCTTGTCATTCAATTTTGCTTTGCTCAAGAACAAGCAGTGAATA CTTTTCCAAATCCTCGTACTAATGGCTACAGTGATTGTGGGCTAAAATCGAAAGGATATGTGTGTGATCCAGATCAACAA TTTACCGAACAAGAAAGATATCGACTGAACAATGATTTGCTTCAACTGTCACAACGAACCTCGGGTGATCAAAGTGCGGA CTTTTGCACCACAAAAGGTGTTGATGCTACTTTATTCATCACAAAACAGGGTAATGAGCAATTAGCACATCAGTTGAATA CCCTTTGGGCTATTGATGAGCAATGTAAAAAATCAATGGTTTTCGTACTTTCGACCAATGACCATAACTTGTAGTTATGC AACGATTTTTTGGCCCAAATNAATTAAACATTNGNCATTTNNGGATTCTTGGAACGGTAGGAACACCGGCTTGGCAAGTG GTGGTTTTTCAATAGTAAGGNAAATTGGCCGTTTTTTCCANTCATTGGCATATTCAGTNAAACGTACCCGTGGTGGAATA GAACGGTAATATGTGATTGAGCGGGAGAATTCGAACATCCATTCATCAGGGAATGTATTCCATTAAATAAGTTTAATGAC TGAGTGGAAGTGATGCTAGCGATATTACGGGCTCCATAATTCAAACTTTTCTTTATCCATTTAATAAATATTTCTCTTAT ACTCTTCACTTGCAGAGGTGAAGCGAAATTGATTTGTGTCAACTCATAAGGATATCGTCGACGAGTAATATCTTTAAAAT CAGACTTCAAAGAATTTTGTTGCACAAAAAATTTGGTTAAATAGTACAAAGAATAATCATTTCGCTTTGATTGCTTGTGA ATATTTTTGATAGCGCACTCTATGTAAGCTCCAAATGCATTTTTTGGTTGATCTGCTGAAAGCACCCTCCCCATCTCACG CTCAGTTTCACCTCTGGCTCCTTCATATAATAATGACATTACGGAAGCGATTGCAAATGGCGATAATAGCGAGGTTTCAT CAGCTTGCGAAGAATAGCGCAATAGTTCCAATGCGAAATTCATTTGCGCCTTAGTTATCAGTAGCTTGTTTGAATCATCA TTGTTTTCAGAACAATGGTTTAAAGTACTGTTAGCACGGGAACTACCACCGAGTACTGCCACCACAATAAATATTACTTC GAAAAGCTTCATGAGGATAATTGCGAATTGCCAATATTGAATAACCTCAAACTTGACGACACAGTGCATTCCGGGTGGCG AAGAATTTGCCACAGCCCTCGCACTGAGGATTAGGTTCATGCATCTGTTTGTGATTGCGAAAGGATGAATCATGGTGGAA TGTCTTCCAACAACCGGGCACTTTGCATTCATAGATGAAGGGCCGACCGTGAGATTTCTAAGGNTAANATTTCTTGTAAT CTTCCGTGATCACAGNAACACCGGGATAATGACAAAANACTTTTGTCTATCGGTTTCGGATCGTTCATGGGTATTTTCCC TGTAGTCGGGACAATCAAGTTATCCGAGAAGTGCTTATTGCCCATATTGTTCTGTTCAGCATTTCCGTGTTGATCGGATG TGTCATCTGGGGAAAGAGTAAGTTGGTGAAAATAGATCGGAACCGCATTTTGTTGTGAACCAGGTAAGTGCATATATGTA ATAATGTCATCGGTGTCGACATTAAGTGGCGAAGAAGTTTCACTTTGAGCATCTCTAATGATAGGATATCGTGCTTTATC ATCATTTGTTTTTAATTCTCCATTAGCATCTCTCCACACATTCCTATTTGAATCTGTATATGAACCAAGTAATGAGCCCA AATTAGTGCGACCCAACAAACCATGGCTGTTTGAAAAGCCAGGATGAGGAGCATTTGTGATCTCGGGTATCGATTCTTTG CTACTTATATCCTCAATTTCACTCAACTGATCGAAATCAATCAACTGCGAAGGATCGGATGGAAATTCTGAGCCAAACAA TGGCTCAAAATTGTTGTAATCAAAGCTGTCTGAGATATCAGAATAAGTATTATTTGTAACAATTTTATCAGCAGCACCAA AATTAGGTAGATGGGAAGTTTATAATTTTATTACCAAAGCCAAAAGCAGAGAAATAAACAAATTTGTGATTCAAAATAGT AACAACATAATGCGAATTTTAGTCGAAAAGACCAAAACCCATATCATCATCTGATTCCTCTTTNGGCTCTTCCTTCTTCT TGTCCTCTTTCTCTTCTGCAGCTGCTGCAGGTGCTGCCGCTGCTGCTGTTGCGGAAGGTGCCGCTACTCCTGCTGCAGCA CCACCACCACTACCAACACTTGAACTAATGTTAGTTATCAACGACTTCACATCAACTCCTTCCAAGGCCTTAGCAAATAA TCCTGGCCAGAATGGTTCCACATCAACATGTGCAGCCTTCAAGATGGTTGAAATTTTATCACCAGTGATTGCAACATCAT CATCTTGCAAAATAAGTGCTGCATAGACGCATGCTAATTCTTGGTTTGCCATTTCTCCTCTTTAGTAAGTGCACGTCGCT ATCAAGCCTTAGCTCTATTTGAGAACAATGCACTATGTCTCAAACTTGGGTAATTACCTGCAGCCCGGGGGATNAAATAG TTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1840: (118 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1031240
1435255
1435261
1435271
1435274
1435279
1435282
1435311
217694808516R47629AS3ISB027SLBrugia malayi infective L3 JHU93SL-BmL3
217718808540R47653AS3ISB056SLBrugia malayi infective L3 JHU93SL-BmL3
217775808597R47710AS3ISB066SLBrugia malayi infective L3 JHU93SL-BmL3
273958878864H14044AS3ISB353SLBrugia malayi infective L3 JHU93SL-BmL3
276418881984H16480AS3ISB273SLBrugia malayi infective L3 JHU93SL-BmL3
281226889983H21288AS3ISB251SLBrugia malayi infective L3 JHU93SL-BmL3
281247890004H21309AS3ISB245SLBrugia malayi infective L3 JHU93SL-BmL3
300024914387H39306SWAMCA293SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320186944802R86396SW3ICA345SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
350204988835H48994SWMFCA041SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
3644691017396H63050AS3ISB086T3Brugia malayi infective L3 JHU93SL-BmL3
3939901081979H91549SWMFCA135SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4061691115074H97263KJ4SLB042T3JHU93SL-BmL4 (JHU)
4061711115076H97265KJ4SLB049T3JHU93SL-BmL4 (JHU)
4425191164667N41069SWMFCA302SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4425381164686N41088SWMFCA309SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4426761164824N41226SW3ICA1061SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446451167446N43144SWMFCA340SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4447841167681N43299SW3ICA769SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448531167750N43352SWMFCA367SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4449671172349N43466AS4SLC792T3Brugia malayi L4 JHU93SL-BmL4
4449751172357N43474AS4SLC817T3Brugia malayi L4 JHU93SL-BmL4
4459621182979N44460SW3ICA1325SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4576551193292N52126KJ4SLB246T3JHU93SL-BmL4 (JHU)
4958711442862N89532KJ4SLB214T3JHU93SL-BmL4 (JHU)
5061091270736N99321SWAMCA540SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594101345231W51617AS4SLC508T3Brugia malayi L4 JHU93SL-BmL4
5594261345247W51633AS4SLC604T3Brugia malayi L4 JHU93SL-BmL4
5594781345299W51586AS4SLC791T3Brugia malayi L4 JHU93SL-BmL4
5594801345301W51588AS4SLC800T3Brugia malayi L4 JHU93SL-BmL4
5595381345359W51512AS4SLC944T3Brugia malayi L4 JHU93SL-BmL4
5679091366657W59919SWAMCA970SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5931031397373W84916SWAMCA1065SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6363451486110AA022328SWMFCA438SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363501486115AA022333SWMFCA447SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363551486120AA022338SWMFCA454SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364101486175AA022393SWMFCA526SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364261486191AA022409SWMFCA573SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364321486197AA022415SWMFCA580SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6378771488476AA023860SWAMCA1049SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6676571537137AA051909SWMFCA890SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6837891550548AA057908SWMFCA907SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6837991550558AA057918SWMFCA918SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838291550588AA057935SWMFCA956SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7566591673284AA118235MBAFCE6H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620171681885AA123574MBAFCE8A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8557851817188AA216484AS4SLC653M13RBrugia malayi L4 JHU93SL-BmL4
8557871817190AA216486AS4SLC655M13RBrugia malayi L4 JHU93SL-BmL4
8639431845391AA224610SWMFCA1038SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8674991849729AA228158SWMFCA1059SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675171849747AA228189SWMFCA1107SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675191849749AA228191SWMFCA1114SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675651849795AA228224SWMFCA1263SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675731849803AA228232SWMFCA1272SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8678801850645AA228539KJ4SLB321T3JHU93SL-BmL4 (JHU)
8713571855013AA231972SWMFCA1367SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8808451870829AA241480MBL2SJ0C8T3Brugia malayi second stage larvae JHU96SL-BmL2
8810171871001AA241696MBL2SJ8E6T3Brugia malayi second stage larvae JHU96SL-BmL2
8810471871031AA241432MBL2SJ8H5T3Brugia malayi second stage larvae JHU96SL-BmL2
8854991876903AA246095SWMFCA1551SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855241876928AA246120SWMFCA1583SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855271876931AA246123SWMFCA1587SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855681876972AA246164SWMFCA1647SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8856041877008AA246187SWMFCA1701SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8944491887874AA253525SWMFCA1412SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8980981892703AA257175SWMFCA1461SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8982021892807AA257305MB4SLM1D10T3Brugia malayi L4 JHU93SL-BmL4
8982221892827AA257351MB4SLM1G3T3Brugia malayi L4 JHU93SL-BmL4
8982731892878AA257402MB4SLM2E4T3Brugia malayi L4 JHU93SL-BmL4
8987061893311AA257730MBL2SJ3F5T3Brugia malayi second stage larvae JHU96SL-BmL2
8987451893350AA257834MBL2SJ4A12T3Brugia malayi second stage larvae JHU96SL-BmL2
9100191906084AA269016SWMFCA1809SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9101061906171AA269109KJ4SLB021T3JHU93SL-BmL4 (JHU)
9140701911994AA273092SWMFCA1838SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9140881912012AA273077SWMFCA1888SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214631923314AA280453SWMFCA1981SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214701923321AA280460SWMFCA1998SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9246631927233AA283575SW3ICA2727SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10750652113542AA430785RRAMCA1445SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987342167904AA454235RRAMCA138SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11161282199269AA471505MBAFCX3C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161792199320AA471556MBAFCX3H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11253602209428AA480730SWMFCA2088SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11253782209446AA480748SWMFCA2120SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11253792209447AA480749SWMFCA2122SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11537882247002AA509125MBAFCX7F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538002247014AA509137MBAFCX7G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538232247037AA509160MBAFCX8A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11587732252950AA514133SWMFCA2235SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11587752252952AA514135SWMFCA2239SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11587982252975AA514158SWMFCA2273SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11588182252995AA514178SWMFCA2298SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11888442289708AA542796MBL2SK3G05T3Brugia malayi second stage larvae JHU96SL-BmL2
11888532289717AA542805MBL2SK3H10T3Brugia malayi second stage larvae JHU96SL-BmL2
11918722307114AA545823SWMFCA2322SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11918982307140AA545849SWMFCA2382SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919002307142AA545851SWMFCA2385SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919172307159AA545868SWMFCA2413SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919282307170AA545879SWMFCA2428SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212262344720AA570830SWMFCA2584SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12213062345203AA570910SWMFCA2732SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354462369541AA584988SWMFCA2805SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354482369543AA584990SWMFCA2810SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354502369545AA584992SWMFCA2813SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12652332402604AA588941KJ4SLE020T3JHU93SL-BmL4 (JHU)
12774112429553AA598360SWMFCA2909SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247302539373AA626986MBAFCW2B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247852539428AA627041MBAFCW2H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813212655441AA675735MBAFCW4B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814282655548AA675842MBAFCW5D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:37:38 on Fri 17 Nov 117.