CBrugiaQ_185


Sequence

>CBrugiaQ_185 (3 EST) Length=684 CTCGTGCCGCAATTATATACNATTAATATTTGTGTTGGGATTGTTTCTCTTTGTTACAGCTTCTTATGAAGAACTATGCA AATTTGCAAACAATGTTACAGATGTGGAAGAGTTGGCGCATCATAAATATCAGGTATTAGAGGATTGCTTGTACTATAAG CTTAGCCAAGATGCCAGCGCAATGCAAGGTAAATCAAATGCTATTAGCATTTTGCCTCCAAGTGTAGCTGCCGGTGAAAC TTTGGATTCNGTGAAACTGTTCCACANATANACACATNNATACGTATGCACACTAGCTACGACAGTNTGTTANTTTACTN TNGACTCTTATTATCAGCGCTATGGAACGGATTCGGAGGATGAAGTGCCACCTGCACATCGATACACATTGCTGGCTTCT GCTCTCAATACTAGCTTGTGTTGCGGAANTGAAACGTGTACTGAAATGGATGGAACTTCAGCGAAAGATTATCACCNAGA TTGGCTACNAATTCATACCGCCATCAATAACGTCGTATCATTCATCATTCTCGTTGCTTATACCAGGGGTATCATTGTCA TTCTATGTGTGTAATAATANCACTGTAACAAAATATGCTGAATTTAATTTTTGAAATTTTAATAAATGCTGTGTTTAAGA CCAATAATGACNANTGGAACNAACAACCATAAAAAGATTCCNAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_185: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807221547285AA054878RRAMCA237SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12354152369510AA584957SWMFCA2679SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354162369511AA584958SWMFCA2680SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:1:21 on Sun 19 Nov 117.