CBrugiaQ_1863


Sequence

>CBrugiaQ_1863 (2 EST) Length=417 CAAGTTTGAGGGTCCATAACCACGTCAAGATGCAGATATTCGTGAAGACGTTAACTGGAAAGACGATTACCCTTGAGGTA GAATCGTCCGATACCATTGAGAATGTGAAGGCTAAAATTCAAGATAAGGAGGGTATTCCACCTGATCAACAACGACTTAT TTTTGCAGTTGGAGGATGGTCGGACGCTCTCTGATTATAATATCCAGAAGGAATCGACACTTCACCTTGTCTTGAGGTAA GCGCTGTTCTGTTGATTCGGATATAGTCAGTTTATTTGCTTCGTGGTTGTGATGTTAACTGTGCTTTGGTGCACTGATTT GATGAATGAAGTTATAGCTCTCTGAGCCACGAATGTTTGTTTTGAAGTTAATGAAAAAATTTTTTTTTGTCTAATAAAAT AATAGATTGCGAGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1863: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987961893401AA257885MBL2SJ4G9T3Brugia malayi second stage larvae JHU96SL-BmL2
9246181926220AA283526SW3ICA2704SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:48:14 on Sat 18 Nov 117.