CBrugiaQ_188


Sequence

>CBrugiaQ_188 (2 EST) Length=679 CAAAGAATACATTCTTAATAGTGCTCANCTAGCAACAATTGCCAAATATTTGCTTGATGCTAGAAGATATAAATCTAGTT TTCAAAGGTGGCAAACAGTTGAATATGAGGATTTGGTTGGTGATTTCGAACAAGCTGCTAGAAACCAGATATATTCAACA TATAATTATCTGCAACAACTTCAAAAAGATAATCATTCTGCTGAAGAGGCGTGGAACTGTGCTTCGGTTGAACTATGTNA AGCAAGTCGATTACACATTCTTTGTTTTATGGCAAAAAGTTATTTATCACGAATATCACAGTGTNGTGAACCAGAAATTT CACGAATATTAAATCTGATTGGCAAACTTTATATGCTTCATGAGATTTCTGCTCATTGTTACGCTTTTAGAATGGCGAAT TATATGTCAGATGAACAAATGAGAAGTGTTAAATGTGGTATCTATGAAATATTGGGGAATTTACGTCCAGATGCTGTAGC TATAGTNGATCNTTTGATTTTTCGGATCGTGAACTTCATTCCGTCCTTGGTCGACGTGACGGTAACGTTTATGCNGCAAT GCTTGAATGGGCAAAATATTCGGAATTGAATAAGACTGAAGTACTGTCAACATTCAAGAACTATTTGGGAACTATGATGG AGGATGGTCGAACCAAAANTTTAANTTTCCCATTGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_188: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11539012247115AA509238MBAFCX8H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212842345181AA570888SWMFCA2657SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:41:52 on Mon 20 Nov 117.